Stem-loop sequence ptc-MIR6445b

AccessionMI0022028 (change log)
DescriptionPopulus trichocarpa miR6445b stem-loop
Gene family MIPF0001621; MIR6445
Stem-loop
   ggcugcuucuu        ------ g      u          u             --c          u        
5'            uuucucuc      u ggcacg uguucauucc cuuccuaaaaugg   uucuucuccu uaguugu 
              ||||||||      | |||||| |||||||||| |||||||||||||   |||||||||| |||||| u
3'            agagggag      g cugugu auaaguaagg gaaggauuuuacc   gaggagagga auuaacg 
   ------cuaac        cauuuu g      c          -             uaa          u        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000351.2: 8556696-8556839 [+]
intergenic
Database links

Mature sequence ptc-miR6445b

Accession MIMAT0025256
Sequence

31 - 

uucauuccucuuccuaaaaugg

 - 52

Get sequence
Evidence experimental; miRNAseq [1], Illumina [2]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).
2