Stem-loop sequence ptc-MIR6449

AccessionMI0022025 (change log)
DescriptionPopulus trichocarpa miR6449 stem-loop
Stem-loop
                     a           uua    augauu 
5' aaaaccguuauucagaau augguuuugau   aacc      c
   |||||||||||||||||| |||||||||||   ||||      a
3' uuuuggcaauaagucuua uaccaaaauug   uugg      g
                     g           -ug    cgauaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000351.2: 678064-678151 [+]
intergenic
Database links

Mature sequence ptc-miR6449

Accession MIMAT0025253
Sequence

67 - 

caugauucugaauaacgguuu

 - 87

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).