Stem-loop sequence ptc-MIR6423

AccessionMI0022024 (change log)
DescriptionPopulus trichocarpa miR6423 stem-loop
Stem-loop
        aaa c cu    u  u   g                --    u  u     g  ucacu      a  g  ag 
5' uccuu   g c  cgcc uc ccg caccgccgcugucgcc  acua cu ccucc cu     ccgguc uc ac  c
   |||||   | |  |||| || ||| ||||||||||||||||  |||| || ||||| ||     |||||| || ||  g
3' aggag   c g  gcgg gg ggc guggcggcggcggcgg  uggu ga ggagg gg     ggucag ag ug  g
        --g a ag    c  c   g                au    u  c     g  --cuu      -  g  gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000337.2: 9702156-9702307 [+]
intergenic
Database links

Mature sequence ptc-miR6423

Accession MIMAT0025252
Sequence

31 - 

ccgcugucgccacuaucuuccu

 - 52

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).