Stem-loop sequence ptc-MIR6447

AccessionMI0022022 (change log)
DescriptionPopulus trichocarpa miR6447 stem-loop
Stem-loop
      ---           acu     -----     -   u    a  u       u             au c         -------      u   guau  uu a 
5' ggc   cggguuucaaa   augag     gucaa auu ucuu ua ucgucac uuuugucaauucg  c aauuggacu       gaacaa gua    cc  g a
   |||   |||||||||||   |||||     ||||| ||| |||| || ||||||| |||||||||||||  | |||||||||       |||||| |||    ||  | g
3' ccg   guucgagguuu   uauuu     uaguu uag ggaa au agcagug aaagcaguuaagu  g uuaaucuga       uuuguu cau    gg  c c
      uuu           -cu     uaaag     a   u    c  c       u             cu a         auaaaca      u   -acu  uu a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000350.2: 5281844-5282046 [-]
intergenic
Database links

Mature sequence ptc-miR6447

Accession MIMAT0025250
Sequence

140 - 

uugacgaaaugugacgacuac

 - 160

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).