Stem-loop sequence ptc-MIR6446

AccessionMI0022021 (change log)
DescriptionPopulus trichocarpa miR6446 stem-loop
Stem-loop
     c                  a c           g            a  a       aacauc   -      --ag a   aggcuauuaggaggucaauuccuuuaccua 
5' cg uuucuuccuuuaaaaaau u aguuccaucau agggcucaguaa ca cauaauu      cua ccaagg    c aga                              g
   || |||||||||||||||||| | ||||||||||| |||||||||||| || |||||||      ||| ||||||    | |||                              c
3' gc aaagaagggaauuuuuua g ucaagguagua uccugggucguu gu guauuaa      gau gguucu    g ucu                              g
     a                  c a           g            c  c       ------   a      gaua c   auuuacggugaguacaguuuuguugugaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000348.2: 13985267-13985488 [-]
intergenic
Database links

Mature sequence ptc-miR6446

Accession MIMAT0025249
Sequence

175 - 

uugcuggguccugaugaugga

 - 195

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).