Stem-loop sequence ptc-MIR6444

AccessionMI0022019 (change log)
DescriptionPopulus trichocarpa miR6444 stem-loop
Stem-loop
       u   ----ag               ---uca  a  g                            uuuuauuuuauauuauaucuuaauuagaaaucua 
5' aagg gca      ggagaauaaauggaa      ca ua aguuaucuuaggaaaauuagagauuaug                                  c
   |||| |||      |||||||||||||||      || || ||||||||||||||||||||||||||||                                   
3' uucc cgu      ccucuuauuuaccuu      gu au uuaauagaauccuuuuaaucucuaauau                                  u
       u   agacua               cuaaac  c  a                            uaauagauguugaguacauacuucuggauuuuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000348.2: 6317192-6317392 [+]
intergenic
Database links

Mature sequence ptc-miR6444

Accession MIMAT0025247
Sequence

43 - 

uaggaaaauuagagauuaugu

 - 63

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).