Stem-loop sequence ptc-MIR6443

AccessionMI0022018 (change log)
DescriptionPopulus trichocarpa miR6443 stem-loop
Stem-loop
      aaa    -       aa     --u   u    uaaagacaaaugaacauuguuucuu 
5' uac   cucc ucauuua  ugauu   ugu gcug                         c
   |||   |||| |||||||  |||||   ||| ||||                          
3' aug   gagg aguagau  acuag   gca uggc                         u
      --g    u       --     uau   c    cacaggggugaucaaagaguuucgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000348.2: 5187433-5187549 [-]
intergenic
Database links

Mature sequence ptc-miR6443

Accession MIMAT0025246
Sequence

93 - 

guaugaucauagaugauggag

 - 113

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).