Stem-loop sequence ptc-MIR6442

AccessionMI0022017 (change log)
DescriptionPopulus trichocarpa miR6442 stem-loop
Stem-loop
           uu u   aug            a      u     a  u  g a 
5' guuugaac  c ugc   ucaagccguuca gccuag cugaa gg ca g g
   ||||||||  | |||   |||||||||||| |||||| ||||| || || |  
3' cggacuug  g acg   aguucggcaagu cggauc ggcuu uc gu c g
           uu c   gga            c      u     a  -  g g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000348.2: 758346-758450 [-]
intergenic
Database links

Mature sequence ptc-miR6442

Accession MIMAT0025245
Sequence

75 - 

cugaacggcuugaagggcacg

 - 95

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).