Stem-loop sequence ptc-MIR6441

AccessionMI0022016 (change log)
DescriptionPopulus trichocarpa miR6441 stem-loop
Stem-loop
                                g ua    -    ---  uuc 
5' cagcaauguaguccuuccgucaacuuuga a  cgug uuac   ac   u
   ||||||||||||||||||||||||||||| |  |||| ||||   ||    
3' gucguuacaucaggaaggcaguugaaacu u  gcac agug   ug   g
                                g -c    c    cac  uac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000347.2: 18360529-18360625 [-]
intergenic
Database links

Mature sequence ptc-miR6441

Accession MIMAT0025244
Sequence

72 - 

aaguugacggaaggacuacau

 - 92

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).