Stem-loop sequence ptc-MIR6439a

AccessionMI0022014 (change log)
DescriptionPopulus trichocarpa miR6439a stem-loop
Gene family MIPF0001526; MIR6439
Stem-loop
        u     g    c   gua  aa       g            c     c     ccgccc   u           cc      uuugaucgcaacgaguuuucaucugcauaugggaagauuuuca 
5' ucaug aaagu aaug uga   ag  gccaaau aagaagcagaag cauca uagcg      uaa uaaaugcucaa  cgucau                                           u
   ||||| ||||| |||| |||   ||  ||||||| |||||||||||| ||||| |||||      ||| |||||||||||  ||||||                                           g
3' aguac uuuca uuac acu   uc  ugguuua uucuucgucuuc guggu gucgu      auu auuuacgaguu  guagug                                           g
        u     a    a   aag  cg       g            a     a     ---aua   c           au      cuccaaacguuagucugaauugacuuacgaugucguaagaaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000347.2: 1164654-1164915 [+]
intergenic
Database links

Mature sequence ptc-miR6439a

Accession MIMAT0025242
Sequence

29 - 

ccaaaugaagaagcagaagcc

 - 49

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).