Stem-loop sequence ptc-MIR6437a

AccessionMI0022012 (change log)
DescriptionPopulus trichocarpa miR6437a stem-loop
Gene family MIPF0001475; MIR6437
Stem-loop
   -   a g     g       -    g   g  g g   ucu 
5'  uag g ugcug ugcugcu ggag cug ug c gug   u
    ||| | ||||| ||||||| |||| ||| || | |||    
3'  auc u gcgac gcgacga ccuc ggc gc g cac   g
   c   g g     g       a    -   g  a g   ucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000337.2: 42466065-42466145 [-]
intergenic
Database links

Mature sequence ptc-miR6437a

Accession MIMAT0025240
Sequence

44 - 

ucacggacggcggcuccaagca

 - 65

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).