Stem-loop sequence ptc-MIR6436

AccessionMI0022011 (change log)
DescriptionPopulus trichocarpa miR6436 stem-loop
Stem-loop
        --aaa  a      a  a                 g 
5' uagau     ag uauugg uc uguuauugggucugguu c
   |||||     || |||||| || |||||||||||||||||  
3' aucug     uc guaacc ag acgauaacucagaccag g
        gguag  -      c  g                 c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000346.2: 21038005-21038085 [-]
intergenic
Database links

Mature sequence ptc-miR6436

Accession MIMAT0025239
Sequence

45 - 

ccagacucaauagcaggaccca

 - 66

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).