Stem-loop sequence ptc-MIR6434

AccessionMI0022009 (change log)
DescriptionPopulus trichocarpa miR6434 stem-loop
Stem-loop
   -g   gaaaaaa   uu        cg         u   u             -----    ag    a      c  - a 
5'   gag       ugu  cauagacu  gucuaugua gcu gaccaaucaaguu     aguc  ugca uugauc ac c u
     |||       |||  ||||||||  ||||||||| ||| |||||||||||||     ||||  |||| |||||| || |  
3'   uuc       aca  guaucuga  cagauacau ugg cugguuaguuuag     ucgg  acgu aauugg ug g c
   cg   -aaguug   cc        au         u   u             uacau    -g    -      u  a a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000346.2: 15332669-15332824 [-]
intergenic
Database links

Mature sequence ptc-miR6434

Accession MIMAT0025237
Sequence

29 - 

cuauguaugcuugaccaauca

 - 49

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).