Stem-loop sequence ptc-MIR6422

AccessionMI0022008 (change log)
DescriptionPopulus trichocarpa miR6422 stem-loop
Stem-loop
   -gu                   c                           
5'    auaaugccaaccauagccu cauuaucacacuauuuuguuugguau 
      ||||||||||||||||||| ||||||||||||||||||||||||| u
3'    uauuacgguugguaucgga guaauagugugguaaaacaaaccauu 
   cgu                   a                           
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000337.2: 5941971-5942068 [+]
intergenic
Database links

Mature sequence ptc-miR6422

Accession MIMAT0025236
Sequence

66 - 

ugugauaaugaaggcuauggu

 - 86

Get sequence
Evidence experimental; miRNAseq [1], Illumina [2]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).
2