Stem-loop sequence ptc-MIR6431

AccessionMI0022005 (change log)
DescriptionPopulus trichocarpa miR6431 stem-loop
Stem-loop
       -      cuu     u                           aa 
5' gauu uugauu   uuaug ggcauaaaagaaucaaaaucgaguugg  u
   |||| ||||||   ||||| |||||||||||||||||||||||||||   
3' cugg aacuaa   aauac ccguauuuucuuaguuuuaguuuaacc  c
       c      aau     -                           au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000337.2: 47209776-47209873 [-]
intergenic
Database links

Mature sequence ptc-miR6431

Accession MIMAT0025232
Sequence

14 - 

uuauguggcauaaaagaaucaa

 - 35

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).