Stem-loop sequence ptc-MIR6429

AccessionMI0022003 (change log)
DescriptionPopulus trichocarpa miR6429 stem-loop
Stem-loop
        uu  uua   --au              c           ca        acaugcaagcuuucaguugacauuucc 
5' auaac  ca   uag    aguuaacucaucac agucaaugcau  cugcuagc                           u
   |||||  ||   |||    |||||||||||||| |||||||||||  ||||||||                            
3' uauug  gu   guu    uuaauugaguagug ucaguuacgua  gaugaucg                           g
        uc  uua   gacu              a           aa        aaaagaagacuccuuaagaaauauauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000337.2: 24230985-24231148 [-]
intergenic
Database links

Mature sequence ptc-miR6429

Accession MIMAT0025230
Sequence

112 - 

uaguagaaaugcauugacuag

 - 132

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).