Stem-loop sequence ptc-MIR6428

AccessionMI0022002 (change log)
DescriptionPopulus trichocarpa miR6428 stem-loop
Stem-loop
   ---g    auu  c      --    uca ua   c      -  c          ----u   -u      g  cag 
5'     gcac   gu gggcuc  gugg   g  ggu uggcaa cu auuagacuca     guu  guuuag cu   c
       ||||   || ||||||  ||||   |  ||| |||||| || ||||||||||     |||  |||||| ||    
3'     ugug   ca cucggg  cacc   c  uca accguu ga uggucugggu     uaa  caaauc ga   a
   uuga    ---  a      uu    -ug gc   a      c  -          uguau   cu      -  cau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000337.2: 24008663-24008803 [-]
intergenic
Database links

Mature sequence ptc-miR6428

Accession MIMAT0025229
Sequence

30 - 

ucuggcaacucauuagacucau

 - 51

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).