Stem-loop sequence ptc-MIR6480

AccessionMI0021997 (change log)
DescriptionPopulus trichocarpa miR6480 stem-loop
Stem-loop
          ccucu   ucgga              u                   u 
5' cucgcaa     guc     acaauaguucaauc uuucagcaaccuuaaauag g
   |||||||     |||     |||||||||||||| |||||||||||||||||||  
3' gaguguu     cag     uguuaucaaguuag aaagucguuggaauuuauc g
          -----   -----              c                   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000345.2: 10834993-10835094 [+]
intergenic
Database links

Mature sequence ptc-miR6480

Accession MIMAT0025223
Sequence

69 - 

uugcugaaacgauugaacuau

 - 89

Get sequence
Evidence experimental; miRNAseq [1], Illumina [2]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).
2