Stem-loop sequence ptc-MIR6479

AccessionMI0021996 (change log)
DescriptionPopulus trichocarpa miR6479 stem-loop
Stem-loop
   u     a  -    -        -----   -          caac         c   c   c        a              a        a  a  --ccaa  --g      aua 
5'  uaguu ag cgug ggcuuuuc     ucu gcaaaauuug    ucaaaguuu cuc agu guuggauu ucaaugagaauacu cugcaaaa au gu      ga   uuuaua   c
    ||||| || |||| ||||||||     ||| ||||||||||    ||||||||| ||| ||| |||||||| |||||||||||||| |||||||| || ||      ||   ||||||    
3'  aucaa uc guac cugaaagg     aga cguuuugaac    aguuucgaa gag uua caaccuaa aguuacucuuauga gacguuuu ua cg      cu   aaguau   c
   a     c  u    u        aaaaa   a          --ac         a   a   a        g              g        c  a  acaaaa  aaa      caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000345.2: 10675110-10675341 [+]
intergenic
Database links

Mature sequence ptc-miR6479

Accession MIMAT0025222
Sequence

65 - 

aucaaugagaauacuacugca

 - 85

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).