Stem-loop sequence ptc-MIR6475

AccessionMI0021990 (change log)
DescriptionPopulus trichocarpa miR6475 stem-loop
Stem-loop
         ----------------------------               u                             uagagaaau   guuu       aa  aaauagagaagccgcauguuaauuuuaaaaugaaaaugaauggcuu 
5' cuugua                            aaugcucuuaucuau cgguggucuugagaaguaaagaacgacga         guu    ugcaagu  uu                                              u
   ||||||                            ||||||||||||||| |||||||||||||||||||||||||||||         |||    |||||||  ||                                               
3' gaacau                            uuacgagaauagaua gccaccagaacucuucauuucuugcugcu         uaa    acguucg  ag                                              u
         accuuuaaauucuuccaucauaccuuua               c                             ----ccaau   -agu       gg  aacaaaguucauacuccuaaaucuauccguagguauaauaguguga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000344.2: 6251397-6251669 [+]
intergenic
Database links

Mature sequence ptc-miR6475

Accession MIMAT0025216
Sequence

29 - 

ucuugagaaguaaagaacgac

 - 49

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).