Stem-loop sequence ptc-MIR6474

AccessionMI0021988 (change log)
DescriptionPopulus trichocarpa miR6474 stem-loop
Stem-loop
          ccuauuuca   u      a          u        c   u    a 
5' gaaagcc         ugu cagauc guagauagca guaguuug uug ggua u
   |||||||         ||| |||||| |||||||||| |||||||| ||| ||||  
3' uuuuugg         aca gucuag caucuaucgu caucagac agu ccau g
          ---------   c      g          u        u   u    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000344.2: 207756-207860 [-]
intergenic
Database links

Mature sequence ptc-miR6474

Accession MIMAT0025213
Sequence

17 - 

uguucagaucaguagauagca

 - 37

Get sequence
Evidence experimental; miRNAseq [1], Illumina [2]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).
2