Stem-loop sequence ptc-MIR6473

AccessionMI0021987 (change log)
DescriptionPopulus trichocarpa miR6473 stem-loop
Stem-loop
       -    a   ua       a      u  a      c             c   c        ca   u      a  ---    c  c           uuc   u 
5' ccau uuga aau  gucguau uguucc aa uuuuga gggauuguggauc gac agguauga  cau guggug ga   agua cu uaucuucauuu   aug a
   |||| |||| |||  ||||||| |||||| || |||||| ||||||||||||| ||| ||||||||  ||| |||||| ||   |||| || |||||||||||   ||| g
3' ggua gacu uug  caguaua acgagg uu agaacu cccuaacaccuag cug uucauacu  gug uaccau cu   ucau ga auggaagugaa   uac a
       a    c   ga       c      u  c      a             a   -        uc   u      g  aua    u  u           --c   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000343.2: 4998388-4998603 [+]
intergenic
Database links

Mature sequence ptc-miR6473

Accession MIMAT0025212
Sequence

166 - 

uccacaaucccaucaagacuu

 - 186

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).