Stem-loop sequence ptc-MIR6440c

AccessionMI0021977 (change log)
DescriptionPopulus trichocarpa miR6440c stem-loop
Stem-loop
       gu   a    u  -      uuuaacccgauuucacacgu            g 
5' ccga  uug ucga uu cgaguu                    acucguaaaauc u
   ||||  ||| |||| || ||||||                    ||||||||||||  
3' gguu  aac aguu aa gcucaa                    ugagcauuuuag a
       ac   -    u  u      -------------------u            c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000341.2: 9126952-9127046 [+]
intergenic
Database links

Mature sequence ptc-miR6440c

Accession MIMAT0025200
Sequence

3 - 

gaguuugaucgauuucgaguu

 - 23

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).