Stem-loop sequence ptc-MIR6467

AccessionMI0021974 (change log)
DescriptionPopulus trichocarpa miR6467 stem-loop
Stem-loop
      --u   -   a                               ucaag 
5' ucu   cag aug uucucaaugauaagcugucgagcguuuuguc     c
   |||   ||| ||| |||||||||||||||||||||||||||||||     u
3' agg   guc uac aagaguuacuauucgacagcucgcaaaacag     g
      cau   g   c                               uaaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000340.2: 16387944-16388043 [+]
intergenic
Database links

Mature sequence ptc-miR6467

Accession MIMAT0025196
Sequence

21 - 

auaagcugucgagcguuuugu

 - 41

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).