Stem-loop sequence ptc-MIR6464

AccessionMI0021971 (change log)
DescriptionPopulus trichocarpa miR6464 stem-loop
Stem-loop
   aga   u      - ua     ---a                                  a 
5'    uga auuuuu u  uuuug    aaauuaugauugcuuguuggauauuauacauauu u
      ||| |||||| |  |||||    ||||||||||||||||||||||||||||||||||  
3'    acu uaagag a  gaaac    uuuaauacuaacgaacaaccuauaauauguauaa a
   -uc   -      u gc     guuc                                  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000340.2: 6850844-6850961 [+]
intergenic
Database links

Mature sequence ptc-miR6464

Accession MIMAT0025192
Sequence

29 - 

ugauugcuuguuggauauuau

 - 49

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).