Stem-loop sequence ptc-MIR6425a

AccessionMI0021970 (change log)
DescriptionPopulus trichocarpa miR6425a stem-loop
Gene family MIPF0001386; MIR6425
Stem-loop
       ccau  a    gaacaag        -uag  uuau   g  ca  c       a  c                    g     --    - -         au     ug 
5' ggac    gc uggc       uugagcug    gg    gau aa  ug uaauuac ag uauugucuuccauggaauag cagug  augg c auuuguuuu  uuucc  a
   ||||    || ||||       ||||||||    ||    ||| ||  || ||||||| || |||||||||||||||||||| |||||  |||| | |||||||||  |||||   
3' ucug    cg aucg       gacuugac    cc    cua uu  ac guuggug uc guaauagaagguaccuuauu gucac  uacc g uaaacaaaa  agagg  g
       ucgu  -    -aacuua        cuga  -ucu   g  -c  a       c  a                    -     aa    a a         --     ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000337.2: 20468178-20468397 [-]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR6425a
ptc-MIR6425cCM000337.2: 20476147-20476366 [-]
ptc-MIR6425bCM000337.2: 20471448-20471667 [-]
ptc-MIR6425aCM000337.2: 20468178-20468397 [-]
Database links

Mature sequence ptc-miR6425a-5p

Accession MIMAT0025190
Sequence

64 - 

uugucuuccauggaauaggcag

 - 85

Get sequence
Evidence experimental; miRNAseq [1]

Mature sequence ptc-miR6425a-3p

Accession MIMAT0025191
Sequence

147 - 

uccauggaagauaaugacucg

 - 167

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).