Stem-loop sequence ptc-MIR6461

AccessionMI0021967 (change log)
DescriptionPopulus trichocarpa miR6461 stem-loop
Stem-loop
   aguuauu    gagag           -ca              u   g              c 
5'        cuua     uuuuuuagacu   aguucugauccaug acu gcuaguugguuuuc u
          ||||     |||||||||||   |||||||||||||| ||| |||||||||||||| u
3'        gagu     aaaaagucuga   ucaaggcuagguac uga cgaucgaucaaaag u
   -----uc    aguca           cuc              u   a              u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000339.2: 16752332-16752456 [+]
intergenic
Database links

Mature sequence ptc-miR6461

Accession MIMAT0025187
Sequence

74 - 

uagcuagcaaguucauggauc

 - 94

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).