Stem-loop sequence ptc-MIR6440b

AccessionMI0021964 (change log)
DescriptionPopulus trichocarpa miR6440b stem-loop
Gene family MIPF0001406; MIR6440
Stem-loop
                     a    c       c   c   -       a 
5' ggguuaaaacucgaaauc guca acucggu aaa ucg uaaaauc g
   |||||||||||||||||| |||| ||||||| ||| ||| ||||||| u
3' uccaauuuugagcuuuag uagu ugagcca uuu agc auuuuag c
                     c    u       a   u   c       c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000339.2: 7164990-7165087 [-]
intergenic
Database links

Mature sequence ptc-miR6440b

Accession MIMAT0025183
Sequence

71 - 

gaguuugaucgauuucgaguu

 - 91

Get sequence
Evidence experimental; miRNAseq [1]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).