Stem-loop sequence ptc-MIR6421

AccessionMI0021962 (change log)
DescriptionPopulus trichocarpa miR6421 stem-loop
Stem-loop
   u        a    a               a    u       ----ca ag      ca 
5'  gaaaucca gugg cuucccuuacaaucu cucu ucaguuu      c  aagauc  g
    |||||||| |||| ||||||||||||||| |||| |||||||      |  ||||||  a
3'  cuuuaggu cacc gaagggaauguuaga gaga aguuaaa      g  uuuuag  u
   a        a    c               c    u       caaacg aa      au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000337.2: 5198860-5198978 [-]
intergenic
Database links

Mature sequence ptc-miR6421-5p

Accession MIMAT0025180
Sequence

18 - 

ucccuuacaaucuacucuuuc

 - 38

Get sequence
Evidence experimental; miRNAseq [1], Illumina [2]

Mature sequence ptc-miR6421-3p

Accession MIMAT0025181
Sequence

84 - 

uagagcagauuguaagggaag

 - 104

Get sequence
Evidence experimental; miRNAseq [1], Illumina [2]

References

1
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).
2