Stem-loop sequence mmu-mir-6420

AccessionMI0021958 (change log)
Symbol MGI:Mir6420
DescriptionMus musculus miR-6420 stem-loop
Stem-loop
   -      -     aaa -        gg   gga      --   u     u 
5'  gggaug gaggg   g uugggggu  gau   gugggg  agu uuguu c
    |||||| |||||   | ||||||||  |||   ||||||  ||| ||||| u
3'  cucuac cuccu   c gaccuuca  cua   uauccu  uca aacaa a
   u      u     aua u        aa   aaa      aa   c     u 
Get sequence
Deep sequencing
16 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 64440806-64440907 [+]
intergenic
Database links

Mature sequence mmu-miR-6420

Accession MIMAT0025176
Sequence

58 - 

acuaauccuauaaaaucaaac

 - 78

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).