Stem-loop sequence mmu-mir-6409

AccessionMI0021946 (change log)
Symbol MGI:Mir6409
DescriptionMus musculus miR-6409 stem-loop
Stem-loop
   -  c     aua   -g  a  g      ---c      - a a    a 
5'  ga gagca   aca  cu gc cgcaug    guggac c g gaca a
    || |||||   |||  || || ||||||    |||||| | | ||||  
3'  cu cucgu   ugu  ga ug gcgugu    cauuug g c cugu g
   u  c     --g   ag  g  g      caaa      u c c    c 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 76008926-76009017 [+]
sense
OTTMUST00000078954 ; RP23-167L1.2-001; exon 14
ENSMUST00000099577 ; Gm5134-001; exon 14
Database links

Mature sequence mmu-miR-6409

Accession MIMAT0025162
Sequence

68 - 

ugcgggugaggaugugugcuccu

 - 90

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).