Stem-loop sequence mmu-mir-6408

AccessionMI0021945 (change log)
Symbol MGI:Mir6408
DescriptionMus musculus miR-6408 stem-loop
Stem-loop
   a   -ac g     ga        u        ----    c    g 
5'  ggc   a ggagg  cauucugu caagcuca    gcua agca g
    |||   | |||||  |||||||| ||||||||    |||| ||||  
3'  ucg   u uuucc  guagggua guucgggu    cggu ucgu g
   g   ggc g     ug        c        acac    a    a 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 60923023-60923113 [+]
intergenic
Database links

Mature sequence mmu-miR-6408

Accession MIMAT0025161
Sequence

55 - 

cacaugggcuugcaugggaugguc

 - 78

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).