Stem-loop sequence mmu-mir-6406

AccessionMI0021943 (change log)
Symbol MGI:Mir6406
DescriptionMus musculus miR-6406 stem-loop
Stem-loop
   c   a  u    guc    aca    g ga   -c  -   ga  -     a   -    cuc 
5'  cca cc ggug   accc   uucc c  ccu  ag gcu  cu caugu gau ccag   c
    ||| || ||||   ||||   |||| |  |||  || |||  || ||||| ||| ||||    
3'  ggu gg cuac   uggg   gggg g  gga  uc cgg  gg guaca cua gguc   a
   a   c  u    -ac    --g    - aa   cc  a   uc  u     c   c    uac 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 68220892-68221011 [+]
antisense
OTTMUST00000013235 ; Ntn1-001; intron 7
ENSMUST00000021284 ; Ntn1-201; intron 6
ENSMUST00000108674 ; Ntn1-001; intron 7
Database links

Mature sequence mmu-miR-6406

Accession MIMAT0025159
Sequence

26 - 

cgcgaccucaggcugacucaug

 - 47

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).