Stem-loop sequence mmu-mir-6403

AccessionMI0021939 (change log)
Symbol MGI:Mir6403
DescriptionMus musculus miR-6403 stem-loop
Stem-loop
   a       --aa    uc       --cc a       c  u cg  c  u    c     ccccau 
5'  uuguccc    ccag  uggcuca    c cugccgc ug g  gc gc gccu uguca      u
    |||||||    ||||  |||||||    | ||||||| || |  || || |||| |||||       
3'  gacgggg    gguc  accgagu    g gacggug ac c  ug cg cgga acggu      a
   a       cggg    -u       cccc a       -  c uu  u  -    a     ucaacg 
Get sequence
Deep sequencing
9 reads, 42.9 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 134567723-134567851 [-]
sense
OTTMUST00000026308 ; Man1c1-001; intron 9
ENSMUST00000054096 ; Man1c1-001; intron 9
ENSMUST00000038628 ; Man1c1-201; intron 10
Database links

Mature sequence mmu-miR-6403

Accession MIMAT0025155
Sequence

74 - 

gcaaaggcgcuguuucccagug

 - 95

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).