Stem-loop sequence mmu-mir-6401

AccessionMI0021937 (change log)
Symbol MGI:Mir6401
DescriptionMus musculus miR-6401 stem-loop
Literature search

1 open access papers mention mmu-mir-6401
(1 sentences)

Stem-loop
   a   c     cau    au   - aa       aua     ------   -   -g    u 
5'  ugc ucaaa   uucc  cug a  ugauacc   acugg      gca cug  cgau c
    ||| |||||   ||||  ||| |  |||||||   |||||      ||| |||  ||||  
3'  acg aguuu   aagg  gac u  gcugugg   ugacc      ugu gac  gcua u
   g   a     -au    --   a gg       ---     ucacau   c   ag    c 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 139779018-139779126 [+]
intergenic
Database links

Mature sequence mmu-miR-6401

Accession MIMAT0025153
Sequence

68 - 

uuacacuccaguggugucgggu

 - 89

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).