Stem-loop sequence mmu-mir-6398

AccessionMI0021934 (change log)
Symbol MGI:Mir6398
DescriptionMus musculus miR-6398 stem-loop
Stem-loop
   a      g     uuu       ggggg   au    ac         a uuu 
5'  aggaua ucuuu   uuugggg     cau  auuc  cucuauuua a   u
    |||||| |||||   |||||||     |||  ||||  ||||||||| |    
3'  uccugu aggaa   ggacucc     gua  uggg  gaggugagu u   u
   g      -     --u       ---aa   ac    ga         a uug 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 123616420-123616521 [+]
antisense
OTTMUST00000020375 ; Macf1-001; intron 1
OTTMUST00000047226 ; Macf1-013; intron 1
OTTMUST00000020789 ; Macf1-005; intron 1
ENSMUST00000082108 ; Macf1-001; intron 1
ENSMUST00000106224 ; Macf1-013; intron 1
ENSMUST00000147030 ; Macf1-005; intron 1
ENSMUST00000097897 ; Macf1-203; intron 1
ENSMUST00000084301 ; Macf1-202; intron 1
Database links

Mature sequence mmu-miR-6398

Accession MIMAT0025150
Sequence

74 - 

gucaaugaaccucagguaagg

 - 94

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).