Stem-loop sequence mmu-mir-6395

AccessionMI0021930 (change log)
Symbol MGI:Mir6395
DescriptionMus musculus miR-6395 stem-loop
Literature search

1 open access papers mention mmu-mir-6395
(1 sentences)

Stem-loop
   a      -----c   ---    cc    u      -        u  c 
5'  gcuggc      cuc   ucug  cugu uaaaga guuugucu uu u
    ||||||      |||   ||||  |||| |||||| |||||||| ||  
3'  cgacug      gag   agac  gaua auuucu uagauaga ag c
   a      ucuucu   uac    cu    u      g        u  a 
Get sequence
Deep sequencing
8385 reads, 41.4 reads per million, 99 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 34166622-34166712 [-]
antisense
ENSMUST00000033933 ; Tmem66-201; intron 3
Database links

Mature sequence mmu-miR-6395

Accession MIMAT0025146
Sequence

3 - 

cuggcccucucugcccuguuua

 - 24

Get sequence
Deep sequencing8384 reads, 99 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).