Dead miRNA entry

miRNA accession:
MI0021929
miRNA ID:
mmu-mir-1957b
Comment:
The sequences annotated as mir-1957 family members are likely fragments of tRNA sequences. Furthermore, the patterns of reads mapping to these loci from deep sequencing experiments do not support their annotation as miRNAs.

Previous miRNA entry

Stem-loop sequence mmu-mir-1957b

AccessionMI0021929 (change log)
Symbol MGI:Mir1957b
DescriptionMus musculus miR-1957b stem-loop
Gene family MIPF0001592; mir-1957
Stem-loop
   a       -----   -   aag     ---            augua        g a  -  -    c 
5'  acauaua     cau cuu   uuucu   uauggggcugga     acucagug u ug gc ugcu a
    |||||||     ||| |||   |||||   ||||||||||||     |||||||| | || || ||||  
3'  uguauau     gua gaa   aaaga   augucccgaccu     ugagucgc g ac ug auga c
   c       aaguc   a   ---     acc            -----        g a  g  u    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mmu-miR-1957b

Accession MIMAT0025145
Sequence

31 - 

uggaauguaacucagugguau

 - 51

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).