Stem-loop sequence mmu-mir-6393

AccessionMI0021927 (change log)
Symbol MGI:Mir6393
DescriptionMus musculus miR-6393 stem-loop
Stem-loop
   -   cu   c   aa c     --     -   -      g c  ucua 
5'  gcc  gcc acg  g acacu  gagug cag ugggcu a ua    u
    |||  ||| |||  | |||||  ||||| ||| |||||| | ||     
3'  cgg  cgg ugu  c uguga  cucac guu acuuga u au    c
   u   uc   u   ca -     ac     u   u      g a  uccu 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 87795850-87795943 [-]
intergenic
Database links

Mature sequence mmu-miR-6393

Accession MIMAT0025143
Sequence

4 - 

cugcccacgaagcacacugagu

 - 25

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).