Stem-loop sequence mmu-mir-6391

AccessionMI0021925 (change log)
Symbol MGI:Mir6391
DescriptionMus musculus miR-6391 stem-loop
Stem-loop
   a    -    ---       a a    agauaa   gag   -   a   aga    u 
5'  ucug ggca   uccuccc g gucu      ugu   gga acu gga   ugcu g
    |||| ||||   ||||||| | ||||      |||   ||| ||| |||   ||||  
3'  agac uugu   aggaggg c cgga      acg   ccu uga ccu   acga c
   a    a    aac       - a    --guga   --a   g   -   ---    c 
Get sequence
Deep sequencing
30 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 118592369-118592472 [-]
sense
ENSMUST00000166646 ; Abcc4-202; intron 18
ENSMUST00000036554 ; Abcc4-201; intron 19
Database links

Mature sequence mmu-miR-6391

Accession MIMAT0025140
Sequence

77 - 

ugaggcacgggaggacaaugu

 - 97

Get sequence
Deep sequencing28 reads, 12 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).