Stem-loop sequence mmu-mir-6390

AccessionMI0021924 (change log)
Symbol MGI:Mir6390
DescriptionMus musculus miR-6390 stem-loop
Stem-loop
   c      u g    ca    ----        ac   cac    gaa    uc  g  gu    a    a 
5'  agguag u gcua  gcaa    caaggaug  gaa   agau   uuga  ag au  aacc uuca a
    |||||| | ||||  ||||    ||||||||  |||   ||||   ||||  || ||  |||| ||||  
3'  uccguc g ugau  cguu    guuucuac  cuu   ucua   agcu  uc ua  uugg gagu g
   c      - g    uc    uaua        --   --u    --a    --  g  gu    a    u 
Get sequence
Deep sequencing
700 reads, 0 reads per million, 44 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 105623642-105623770 [-]
intergenic
Database links

Mature sequence mmu-miR-6390

Accession MIMAT0025139
Sequence

41 - 

gaauugaucaggauguaacca

 - 61

Get sequence
Deep sequencing684 reads, 52 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).