Stem-loop sequence mmu-mir-6388

AccessionMI0021920 (change log)
Symbol MGI:Mir6388
DescriptionMus musculus miR-6388 stem-loop
Stem-loop
   cu     ug       gag  ca  a    -- -   ag 
5'   gcaga  gcacagu   gc  ca aucc  c cau  a
     |||||  |||||||   ||  || ||||  | |||   
3'   ugucu  uguguca   cg  gu uagg  g gua  g
   -u     cu       -ga  ag  a    aa a   ga 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 115695720-115695794 [-]
intergenic
Database links

Mature sequence mmu-miR-6388

Accession MIMAT0025135
Sequence

2 - 

ugcagauggcacagugaggcc

 - 22

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).