Stem-loop sequence mmu-mir-6386

AccessionMI0021918 (change log)
Symbol MGI:Mir6386
DescriptionMus musculus miR-6386 stem-loop
Stem-loop
   u    ----a   c    --    -    g aa    uuaga        guuua    u 
5'  cagc     ugc uuag  ggug ggau c  gucu     caagagug     gggc a
    ||||     ||| ||||  |||| |||| |  ||||     ||||||||     ||||  
3'  gucg     acg aguc  ucac cuua g  caga     guuuuuau     uccg a
   -    gaacg   u    gu    u    g ga    -----        -----    g 
Get sequence
Deep sequencing
189 reads, 0 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 92267258-92267361 [-]
antisense
OTTMUST00000055399 ; Plscr1-001; intron 7
ENSMUST00000093801 ; Plscr1-001; intron 7
Database links

Mature sequence mmu-miR-6386

Accession MIMAT0025133
Sequence

5 - 

caugccuuagggugggaugcaagu

 - 28

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).