Stem-loop sequence mmu-mir-6384

AccessionMI0021915 (change log)
Symbol MGI:Mir6384
DescriptionMus musculus miR-6384 stem-loop
Stem-loop
   c  gg agc        -  u   c   ua 
5'  ag  c   uuuccuac ug uuc cug  a
    ||  |   |||||||| || ||| |||   
3'  uc  g   gaggggug ac gag gac  u
   u  aa gua        c  c   u   uc 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 52378121-52378181 [-]
sense
OTTMUST00000042115 ; Gpc3-001; intron 5
ENSMUST00000069360 ; Gpc3-001; intron 5
Database links

Mature sequence mmu-miR-6384

Accession MIMAT0025130
Sequence

8 - 

gcuuuccuacuguuucccug

 - 27

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).