Stem-loop sequence mmu-mir-6381

AccessionMI0021912 (change log)
Symbol MGI:Mir6381
DescriptionMus musculus miR-6381 stem-loop
Stem-loop
   u    -au     u  cau   u  a   --a  --ga     g  ca 
5'  cagg   gcugg ga   gag ga cag   ag    accaa ca  g
    ||||   ||||| ||   ||| || |||   ||    ||||| ||   
3'  guuc   cgacc cu   cuc cu guc   uc    ugguu gu  a
   u    gau     -  --u   -  -   cac  acgg     -  uu 
Get sequence
Deep sequencing
11 reads, 25 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 142623860-142623946 [-]
antisense
OTTMUST00000094412 ; Gbp2-001; 3'UTR (exon 2)
OTTMUST00000094413 ; Gbp2-002; 3'UTR (exon 2)
ENSMUST00000165774 ; Gbp2-001; 3'UTR (exon 2)
ENSMUST00000169572 ; Gbp2-002; 3'UTR (exon 2)
Database links

Mature sequence mmu-miR-6381

Accession MIMAT0025127
Sequence

2 - 

caggaugcuggugacaugagu

 - 22

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).