Stem-loop sequence mmu-mir-6380

AccessionMI0021911 (change log)
Symbol MGI:Mir6380
DescriptionMus musculus miR-6380 stem-loop
Stem-loop
   a    cu  ug    u     ac   - u    a ug  aa 
5'  gcuu  gg  guug aagca  uau g ggau c  gg  u
    ||||  ||  |||| |||||  ||| | |||| |  ||  c
3'  cgag  uc  caau uucgu  aug c ccug g  cc  a
   c    --  gu    u     ga   u u    - gu  ag 
Get sequence
Deep sequencing
71 reads, 111 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 137783535-137783615 [-]
intergenic
Database links

Mature sequence mmu-miR-6380

Accession MIMAT0025126
Sequence

57 - 

uguaagugcuuuuaacugcugagc

 - 80

Get sequence
Deep sequencing46 reads, 25 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).