Stem-loop sequence mmu-mir-6379

AccessionMI0021910 (change log)
Symbol MGI:Mir6379
DescriptionMus musculus miR-6379 stem-loop
Stem-loop
   c  g    c   ugg     ucag   ---aag       a      g    -     aa 
5'  ca caaa agu   uugag    guc      gucuagc gugaaa cuuu gggaa  u
    || |||| |||   |||||    |||      ||||||| |||||| |||| |||||   
3'  gu guuu uca   gacuc    cgg      uagaucg cauuuu gagg cccuu  g
   a  g    c   -ua     -cca   acugaa       a      -    u     cu 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 46900668-46900782 [-]
intergenic
Database links

Mature sequence mmu-miR-6379

Accession MIMAT0025125
Sequence

62 - 

ucccuggaguuuuacagcuaga

 - 83

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).