Stem-loop sequence mmu-mir-6378

AccessionMI0021909 (change log)
Symbol MGI:Mir6378
DescriptionMus musculus miR-6378 stem-loop
Stem-loop
   u   g    g    c       ca  c  -      guu    auug      cug 
5'  cuc caug uuca gggagga  ca gc guuucu   ggug    gggagc   c
    ||| |||| |||| |||||||  || || ||||||   ||||    ||||||    
3'  gag guau aagu cucuuuu  gu cg caagga   uuac    cccuug   c
   u   -    a    -       -a  c  u      aug    ---a      uuu 
Get sequence
Deep sequencing
7 reads, 125 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 34922545-34922651 [-]
intergenic
Database links

Mature sequence mmu-miR-6378

Accession MIMAT0025124
Sequence

8 - 

ugguucacgggaggacacacgc

 - 29

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).