Stem-loop sequence mmu-mir-6377

AccessionMI0021907 (change log)
Symbol MGI:Mir6377
DescriptionMus musculus miR-6377 stem-loop
Stem-loop
   c u    c   -     g   cc      ac   u    g     c ggu    u  u 
5'  g ugca aua gaaga aaa  ugaagu  uug cuuu ugagu u   uuau uu u
    | |||| ||| ||||| |||  ||||||  ||| |||| ||||| |   |||| || c
3'  c acgu ugu cuucu uuu  acuuca  agc ggga acuua a   aaua aa u
   a u    c   g     g   --      -c   u    g     u -au    c  u 
Get sequence
Deep sequencing
11 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 57616609-57616722 [+]
intergenic
Database links

Mature sequence mmu-miR-6377

Accession MIMAT0025122
Sequence

91 - 

ucauuugucuucgugucugcauc

 - 113

Get sequence
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).