Stem-loop sequence mmu-mir-6375

AccessionMI0021904 (change log)
Symbol MGI:Mir6375
DescriptionMus musculus miR-6375 stem-loop
Stem-loop
   g    g    aau      acu     --cc  ag    ---    c  cau 
5'  gcau ugug   uggcug   guauu    aa  uggg   gcuu ga   a
    |||| ||||   ||||||   |||||    ||  ||||   |||| ||    
3'  ugug acac   aucgac   cauag    uu  accu   cgaa uu   a
   a    -    --c      ---     uaaa  ga    uua    u  aga 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 85790140-85790234 [-]
antisense
OTTMUST00000087646 ; Alms1-ps2-001; intron 2
ENSMUST00000161983 ; Alms1-ps2-001; intron 2
Database links

Mature sequence mmu-miR-6375

Accession MIMAT0025119
Sequence

10 - 

gaauuggcugacuguauuccaaa

 - 32

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:22319597 "Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function" Humphreys DT, Hynes CJ, Patel HR, Wei GH, Cannon L, Fatkin D, Suter CM, Clancy JL, Preiss T PLoS One. 7:e30933(2012).